
Creation
138 kr.
138 kr.
Tidligere laveste pris:
145 kr.
Man., 14 apr. - tirs., 22 apr.
Sikker betaling
14 dages åbent køb
Sælges og leveres af
Adlibris
Produktbeskrivelse
Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.
'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday
The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.
'A superbly written explanation' Brian Cox
This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.
'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph
'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer
'The perfect primer on the past and future of DNA' Guardian
'Susenseful, erudite and thrilling' Prospect
'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain
'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili
'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk
'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts
'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome
'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Varenr.
8f8fecd1-1d15-439e-989a-bdb9e738477b
Creation
138 kr.
138 kr.
Tidligere laveste pris:
145 kr.
Man., 14 apr. - tirs., 22 apr.
Sikker betaling
14 dages åbent køb
Sælges og leveres af
Adlibris
Lignende topsælgere

Bright Beauty Vanity Namira - make up spejl med belysning - hollywood spejl - schminke spejl med lys - hvid - dæmpbar med tre lystilstande
539 kr.
Tidligere laveste pris:
659 kr.

Timer til Klasselokalet - 60 minutter
169 kr.

Apple AirPods (anden generation) med Lightning-opladningsetui
1.099 kr.

FENCHILIIN Hollywood Makeup Spejl Med Lys dæmpbar med tre lystilstande Bordplade vægbeslag hvid 58 x 46cm
551 kr.
Tidligere laveste pris:
641 kr.

G4 Halogenpærer / Stiftpærer - Halogen 10W (10-Pack)
69 kr.

FENCHILIIN Stor Hollywood Makeup Spejl med lys USB bordplade vægbeslag hvid 80 x 58 cm
961 kr.
Tidligere laveste pris:
982 kr.

Ørepuder til Bose QuietComfort - QC35/QC25/QC15/AE2 Hovedtelefoner Svart
69 kr.

Universal 250 m afgrænsningskabel til robotplæneklippere + 800 pløkker
397 kr.
Tidligere laveste pris:
555 kr.

Universal 250 m afgrænsningskabel til robotplæneklippere
303 kr.

FENCHILIIN Hollywood makeup spejl med lys forstørrelse 360° drejelig bordplade hvid spejl 30 x 41 cm
391 kr.
Tidligere laveste pris:
461 kr.
Anbefalede produkter

2-i-1 foldeløbebånd, elektrisk løbebånd under skrivebordet, jogging til hjemmekontoret Sort
1.549 kr.

Blodtryksmåler til overarmen med hukommelsesfunktioner
169 kr.

16 pakke barberblade, der er kompatible med Fusion 5
93 kr.

Playstation 5 DualSense Controller Midnight Black
549 kr.

Wii til HDMI Adapter 1080p Full-HD kompatibel til Nintendo
50 kr.

2-Pak - Lader til iPhone - Hurtiglader - Adapter + Kabel 20W USB-C
139 kr.

94 CM 3 X Plæneklipperknive til Husqvarna RIDER R213 R214 R215 R216 R316 R318 R320 AWD
265 kr.

RCA AV till HDMI Converter / Adapter 1080P Universal White
79 kr.

Ersättningsfjärrkontroll för Chromecast Google TV G9N9N
79 kr.
Tidligere laveste pris:
89 kr.

FENCHILIIN Hollywood stort makeup spejl med lamper bordplade vægmonteret hvid spejl med lys
479 kr.
Tidligere laveste pris:
539 kr.